>M13 Forward (−21)
TGTAAAACGACG…ACTGGCCGTCGT…>M13/pUC Reverse
AGCGGATAACAA…CCTGTGTGAAAT…>T7
TAATACGACTCA…CCCTATAGTGAG…Sequencing primers (multi-FASTA)
Reverse complement common sequencing primers together.
Reverse Complement Calculator
FigranPaste DNA, RNA or FASTA to get the reverse complement, GC content and translation.
- Multi-FASTA and GenBank
- IUPAC codes and RNA
- Runs in your browser
Reverse complement sequences
Calculating…
Reverse complement calculator examples
Explore common sequence formats and use an example as a starting point.
>27F
AGAGTTTGATCM…CTGAGCCAKGAT…>1492R
GGTTACCTTGTT…AAGTCGTAACAA…>515F
GTGYCAGCMGCC…TTACCGCGGCKG…Degenerate 16S rRNA primers
Keep ambiguity codes in primer sequences.
>L09137
tcgcgcgtttcggtgatgacggtgaaaacctctgacacat…cacccgctgacgcgccctgacgggcttgtctgctcccggc…GenBank ORIGIN paste
Read the sequence from a GenBank record.
>hsa-let-7a-5p
UGAGGUAGUAGGUUGUAUAGUUAACUAUACAACCUACUACCUCAmicroRNA and antisense probe
Keep RNA as RNA in the result.
>pUC19c L09137
TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACAT…GACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAA…Whole plasmid
Inspect the sequence and its reading frames.
>EGFP forward
gcgaattcATGG…CTCCTCGCCCTT…>EGFP reverse
gcctcgagTTAC…GGCATGGACGAG…Cloning primers with lowercase tails
Preserve the case of cloning tails.
How to reverse complement a sequence
Turn a sequence into a result in four steps.
1Paste or open a sequence
Enter DNA, RNA, FASTA or a GenBank record.
2Choose an operation
Select reverse complement, reverse or complement.
3Check the result
Review sequence counts, GC content and reading frames.
4Copy or download
Take the result to your next analysis.
Reverse, complement or reverse complement
A complementary DNA strand runs in the opposite direction. A reverse primer is written 5′ to 3′ as the reverse complement of the target strand. To check primer melting temperature, use the Primer Tm Calculator.
1 Reverse complement
ACGTACGCATGC2 Reverse
TGCATGCGTACG3 Complement
CGTACGCATGCA5′-GCATGCGTACGT-3′ 3′-CGTACGCATGCA-5′
IUPAC codes and RNA
Ambiguity codes are complemented as shown. RNA input stays RNA unless you choose DNA output.
| Code | Bases | Complement |
|---|---|---|
| A | A | T |
| C | C | G |
| G | G | C |
| T | T | A |
| Code | Bases | Complement |
|---|---|---|
| R | A/G | Y |
| Y | C/T | R |
| S | G/C | S |
| W | A/T | W |
| K | G/T | M |
| M | A/C | K |
| Code | Bases | Complement |
|---|---|---|
| B | C/G/T | V |
| D | A/G/T | H |
| H | A/C/T | D |
| V | A/C/G | B |
| N | A/C/G/T | N |
Reference: NC-IUB (1985)
GC content and six-frame translation
S counts as GC and W as AT. Other ambiguity codes are excluded from the denominator. A degenerate codon translates to an amino acid only when every possible codon agrees; otherwise it is X.
GC% = (G + C + S) / (A + T + U + G + C + S + W) × 100
+15′ ─────────────→ 3′
+25′ ─────────────→ 3′
+35′ ─────────────→ 3′
−13′ ←───────────── 5′
−23′ ←───────────── 5′
−33′ ←───────────── 5′
Reference: NCBI Genetic Codes
Reverse complement calculator FAQ
What is a reverse complement?
It is the complementary strand written 5′ to 3′: complement the bases and reverse their order.
Is my reverse primer the reverse complement?
Yes. A reverse primer is written 5′ to 3′ as the reverse complement of its target on the forward strand.
Is the complementary strand written 5′ to 3′ or 3′ to 5′?
Aligned with the input, the complementary strand runs 3′ to 5′. Its reverse complement is written 5′ to 3′.
How are IUPAC ambiguity codes and RNA handled?
IUPAC codes are complemented by their possible bases. RNA input stays RNA by default.
What gets removed from a pasted sequence?
Whitespace, digits and slashes are removed. GenBank and EMBL annotations outside the sequence block are ignored; other invalid characters cause an error.
How is GC content calculated with N or other ambiguity codes?
S counts as GC and W as AT; other ambiguity codes do not enter the denominator.
How does this compare with ExPASy Translate?
Both use six reading frames and NCBI genetic codes. ExPASy offers additional translation options.
Does this match the Sequence Manipulation Suite?
For clean DNA FASTA, the reverse complement follows the same base-pairing rules.
Are my sequences uploaded?
No. Sequences are processed in your browser.
How do I reverse complement in Python or R?
In Biopython use Seq(s).reverse_complement(); in Biostrings use reverseComplement(DNAString(s)).
Ready to work with your sequence?
Reverse complement DNA or RNA in your browser.
Reverse complement a sequence