Annealing temperature72.0 °C
Forward primer74.2 °C
Reverse primer75.0 °C
M13 / pUC sequencing primers
A sequencing pair with Q5 buffer conditions.
Primer Tm Calculator
FigranPaste a primer pair to get Tm, annealing temperature and dimer checks.
- NEB and Primer3 comparisons
- Annealing by polymerase
- Dimer checks
Primer results
Annealing temperature72.0 °CLower Tm + 1 °C, maximum 72 °C
Forward primer17 nt · 52.9% GC74.2 °C
Reverse primer24 nt · 41.7% GC75.0 °C
Primer checks
- GC content 40–60%
- 3′ GC clamp
- Run of four or more identical bases
- No fourfold dinucleotide repeat
- Tm difference at most 5 °C
Secondary structure · −5.5 kcal/mol
Screening estimate at 37 °C for pairings with at least three matched bases; bulges and hairpins are not modeled.
Self-dimer · Forward primer: −5.5 kcal/mol
5′ GTAAAACGACGGCCAGT 3′
||||
3′ TGACCGGCAGCAAAATG 5′3′ end involved: 0.0 kcal/mol
5′ GTAAAACGACGGCCAGT 3′
|| |
3′ TGACCGGCAGCAAAATG 5′Self-dimer · Reverse primer: −1.7 kcal/mol
5′ AGCGGATAACAATTTCACACAGGA 3′
||||
3′ AGGACACACTTTAACAATAGGCGA 5′Cross-dimer: −2.7 kcal/mol
5′ GTAAAACGACGGCCAGT 3′
| ||
3′ AGGACACACTTTAACAATAGGCGA 5′3′ end involved: −1.7 kcal/mol
5′ GTAAAACGACGGCCAGT 3′
|| ||
3′ AGGACACACTTTAACAATAGGCGA 5′Oligo properties
Forward primer: Molecular weight 5,228.5 g/mol · Extinction coefficient ε₂₆₀ 172,500 M⁻¹ cm⁻¹ · 5.80 nmol/OD · 30.31 µg/OD
Reverse primer: Molecular weight 7,378.9 g/mol · Extinction coefficient ε₂₆₀ 248,700 M⁻¹ cm⁻¹ · 4.02 nmol/OD · 29.67 µg/OD
| Name | Sequence | Length | GC content (%) | Tm (°C) | Annealing temperature (°C) | ΔTm (°C) |
|---|---|---|---|---|---|---|
| GTAAAACGACGGCCAGT | 17 | 52.9 | 74.2 | 72.0 | 0.8 | |
Details: Forward primerPair: Reverse primer Most stable ΔG (kcal/mol): −5.5 Flags: No 3′ GC clamp; Run of ≥4 identical bases | ||||||
| AGCGGATAACAATTTCACACAGGA | 24 | 41.7 | 75.0 | 72.0 | 0.8 | |
Details: Reverse primerPair: Forward primer Most stable ΔG (kcal/mol): −5.5 Flags: No 3′ GC clamp | ||||||
Primer Tm calculator examples
Load a published primer pair to explore the results.
Annealing temperature67.9 °C
Forward primer66.9 °C
Reverse primer73.8 °C
T7 promoter / terminator
A promoter and terminator primer pair.
Annealing temperature48.7 °C
Forward primer57.2 °C
Reverse primer53.7 °C
Human GAPDH qPCR pair
A human reference-gene pair under Primer3 conditions.
Annealing temperature70.4 °C
Forward primer72.1–74.5 °C
Reverse primer69.4 °C
16S rRNA 27F / 1492R
A degenerate primer pair spanning bacterial 16S rRNA.
Annealing temperature67.5 °C
Forward primer82.0–88.5 °C
Reverse primer66.5–74.6 °C
16S V4 515F / 806R
Degenerate primers for the 16S V4 region.
Annealing temperature72.0 °C
Forward primer81.0 °C
Reverse primer71.9 °C
Fungal ITS1 / ITS4
A pair targeting fungal ITS regions.
Annealing temperature53.6 °C
Forward primer58.6 °C
Reverse primer62.6 °C
Probe68.2 °C
CDC 2019-nCoV N1 primers and probe
Published N1 primers with the unmodified probe sequence.
Annealing temperature72.0 °C
Forward primer82.6 °C
Reverse primer77.6 °C
Cloning primers with restriction-site tails
Lowercase restriction-site tails are excluded by default.
How to calculate primer Tm
Use the reaction conditions that match your experiment.
1Choose a polymerase
Select its buffer or enter custom conditions.
2Paste primers
Enter a pair or a batch of DNA sequences.
3Review the results
Compare Tm, annealing temperature and primer checks.
4Take results with you
Copy the table or download a CSV file.
Why Tm calculators disagree
Calculators differ in their salt and concentration assumptions.
GAPDH primers for qPCR analysis: F GAAGGTGAAGGTCGGAGTC; R GAAGATGGTGATGGGATTTC. Each row uses the same sequences with different conditions.
Use each annealing rule with the Tm method it was designed for.
| Conditions | Forward Tm | Reverse Tm | Annealing temperature |
|---|---|---|---|
| NEB Q5 · 500 nM | 75.8 °C | 70.6 °C | 71.6 °C |
| NEB Taq standard buffer · 500 nM | 68.6 °C | 63.0 °C | 58.0 °C |
| Thermo calculator · 500 nM; buffer composition undisclosed | 62.4 °C | 59.1 °C | 59.1 °C |
| Primer3 · 50 mM Na⁺, 1.5 mM Mg²⁺, 0.6 mM dNTPs, 50 nM | 57.2 °C | 53.7 °C | — |
| ConductScience · 50 mM Na⁺, 1.5 mM Mg²⁺, 250 nM | 54.4 °C | 49.5 °C | — |
| Wallace rule | 60.0 °C | 58.0 °C | — |
Annealing temperature by polymerase
Use the lower primer Tm with the selected polymerase rule.
For custom conditions, subtracting 5 °C is a common starting point; verify with a gradient PCR.
| Polymerase | Annealing rule |
|---|---|
| Q5 / Q5 Hot Start (NEB buffer) | Lower Tm + 1 °C, max 72 °C |
| OneTaq (Standard buffer) | Lower Tm − 5 °C, max 68 °C |
| OneTaq (GC buffer) | Lower Tm − 5 °C, max 68 °C |
| Taq (Standard Taq buffer) | Lower Tm − 5 °C, max 68 °C |
| Taq (ThermoPol buffer) | Lower Tm − 5 °C, max 68 °C |
| LongAmp Taq | Lower Tm − 5 °C, max 65 °C |
| Primer3 / Primer-BLAST defaults | Lower Tm − 5 °C; validate by gradient |
| Custom reaction | Lower Tm − 5 °C; validate by gradient |
Primer dimers
More negative ΔG indicates a more stable predicted interaction.
Pairing at a 3′ end can be especially relevant to amplification. This tool screens dimers but does not predict hairpins.
1 Self-dimer
5′ GTAAAACGACGGCCAGT 3′
||||
3′ TGACCGGCAGCAAAATG 5′2 Cross-dimer
5′ GTAAAACGACGGCCAGT 3′
| ||
3′ AGGACACACTTTAACAATAGGCGA 5′3 3′ end involved
5′ GTAAAACGACGGCCAGT 3′
|| ||
3′ AGGACACACTTTAACAATAGGCGA 5′How primer Tm is calculated
Nearest-neighbor thermodynamics account for sequence and reaction salts.
L = ln[Mg²⁺], with free magnesium in molar units; fGC is the GC fraction and N is sequence length. Coefficients change for mixed-ion conditions.
Baseline coefficients
a = 3.92 · b = −0.911 · c = 6.26 · d = 1.42 · e = −48.2 · f = 52.5 · g = 8.31
The mixed-ion branch adjusts a, d and g according to monovalent ion concentration.
References: SantaLucia 1998 · Owczarzy et al. 2008
Primer Tm calculator FAQ
What is primer Tm?
Tm (melting temperature) is the temperature at which half of a primer population is paired with its complementary strand under specified conditions. It depends on sequence, salt and primer concentration.
How do I get the annealing temperature from primer Tm?
Use the lower primer Tm with the rule for your polymerase. Taq-type rules often subtract 5 °C, while Q5 uses a higher value; verify the result with gradient PCR.
Why does NEB give a higher Tm than other calculators?
Different buffer and concentration conventions can shift calculated Tm. Use the associated polymerase rule with its own Tm values.
Does this match the NEB Tm Calculator?
Across the listed NEB presets, results matched the NEB Tm Calculator for 54 distinct test primers under their tested conditions in November 2026. Future changes may alter that agreement.
What Tm difference between forward and reverse primers is acceptable?
A difference of at most 5 °C is a common starting point. The polymerase and assay can require further optimization.
What ΔG means a primer dimer is a problem?
More negative ΔG values indicate more stable predicted interactions, but no single threshold guarantees assay performance. Check 3′ pairing and validate experimentally.
How is GC content calculated, and does it change Tm?
GC content is the fraction of G and C bases. GC-rich sequences often have higher Tm, although the order of bases matters too.
Should restriction sites or Gibson overlaps count toward Tm?
For the first amplification cycles, the 5′ tail does not pair with the original template. Lowercase tails are excluded by default.
Are my primer sequences uploaded?
No. Calculations run in your browser.